CS 5984 Fall 2000 Homework Assignment 1

50 Points
Due: 8/28/00 at 5:00PM

The point value of each problem is shown in square brackets [ ]. Your solutions must be prepared with LaTeX or other word processing system and submitted as a stapled printout to a box outside the instructor's office (McBryde 638). This homework is due at 5:00PM on August 28, 2000. No late homework will be accepted.

  1. [25] Start with the DNA sequence ATAGAC. Call it MAIN.

    1. Draw a schematic of a double-strand of DNA with MAIN on one of the strands. Use the style of Figure 1.7 in S&M. Carefully label the 5' and 3' ends of each strand.

    2. Assume that MAIN is part of the template or antisense strand for some gene NOVEL. Draw a chemical diagram of the RNA strand transcribed from MAIN. See Figures 1.4 and 1.5 in S&M. Carefully label the 5' and 3' ends of the strand.

    3. The gene NOVEL codes for a protein WORK. What amino acid sequence, corresponding to MAIN, occurs in WORK?

  2. [25] Go to http://www.ncbi.nlm.nih.gov/ with your web browser and find out how to do a BLAST search in GenBank. Do a BLAST search on this nucleotide sequence 
    AATTTTGGCCCCTCCCCACTGCACGACGGTAAGCCCCTGTTCAACAATGGCTTCTCTGCT
CAGAAACGAGACTCTCTACGGCGGCCTGGTTTGTGTCCCAAGCAAGAGCCGGCCGTTCCA
GTTCTTCCGTCCCCTGATGTTCAGGCTTCTACTTGCGTTAATATCGGGAACCTTTCGCCA
AATCCGGCAGTCGAGAAACAGACGNNNTCTAATAAAAAACCGATGNNNTTNNNCG
    .
    1. From the BLAST result, identify the database searched and its size. Calculate the size of the database as a number of bits. Explain your calculation.

    2. How many BLAST hits did you get? List the top three along with what score you got for each and what the score means. (You are not expected to really know this yet; just take a stab at it. HINT: smaller E-values correspond to better hits.)

    3. Vary the BLAST parameters until you get better hits. Can you summarize the hits in two or three sentences? (Again, do the best you can for the moment; you will be able to give a better answer later.)

Please report any problems found in these pages to:

CS5984 Class Account (algnbio@courses.cs.vt.edu)